Cells transiently expressing periostin are required for intramedullary intramembranous bone regeneration (2025)

Table of Contents

Abstract Introduction Materials and Methods Generation of Postn-creERT2BAC transgenic mice Mice Bone marrow ablation surgery Histology, immunofluorescence, and immunohistochemistry RT-qPCR Flow cytometry Microcomputed tomography Tissue clearing and lightsheet microscopy Statistical analysis Results Figure 1. Figure 2. Figure 3. Figure 4. Figure 5. Discussion Supplementary Material Figure 6. Highlights. Acknowledgments Funding Source: Footnotes References Associated Data Supplementary Materials

Abstract

Intramembranous bone regeneration plays an important role in fixation of intramedullary implants used in joint replacement and dental implants used in tooth replacement. Despite widespread recognition of the importance of intramembranous bone regeneration in these clinical procedures, the underlying mechanisms have not been well explored. A previous study that examined transcriptomic profiles of regenerating bone from the marrow space in an animal model of induced intramembranous bone regeneration showed that increased periostin gene expression preceded increases in several well-known osteogenic genes such as Runx2 or Bglap. We therefore sought to determine the role of cells transiently expressing periostin in intramedullary intramembranous bone regeneration. We used a genetic mouse model that allows tamoxifen-inducible fluorescent labeling of periostin expressing cells. These mice underwent ablation of the bone marrow cavity through surgical disruption, a well-established intramembranous bone regeneration model. We found that in intact bones, fluorescently labeled cells were largely restricted to the periosteal surface of cortical bone and were absent in bone marrow. However, following surgical disruption of the bone marrow cavity, cells transiently expressing periostin were found within the regenerating tissue of the bone marrow compartment even though the cortical bone remained intact. The source of the intramedullary these cells is likely heterogenous, including cells occupying the periosteal surface as well as pericytes and endothelial cells within the marrow cavity. We also found that diphtheria toxin-mediated depletion of cells transiently expressing periostin at the time of surgery impaired intramembranous bone regeneration in mice. These data suggest a critical role of periostin expressing cells in intramedullary intramembranous bone regeneration and may lead to novel therapeutic interventions to accelerate or enhance implant fixation.

Keywords: periostin, bone regeneration

Introduction

Bone repair occurs via two distinct processes: intramembranous and endochondral bone regeneration. Unlike endochondral bone regeneration which has received wide-spread attention (1-4), the mechanisms underlying intramembranous bone regeneration have been underexplored and are inferred from the embryonic development of membranous bones where mesenchymal cells directly differentiate to osteoblasts (5). Given that in the U.S. alone ~900,000 joint replacement surgeries and ~2 million dental implant procedures are performed every year and are dependent on successful intramedullary intramembranous bone regeneration (6-8), further elucidating the mechanisms may ultimately lead to enhanced care for patients undergoing these procedures.

The underlying molecular mechanisms of intramembranous bone regeneration have been examined in animal models of cortical bone and cranial defects, distraction osteogenesis, stress fracture healing, and surgical bone marrow ablation (9-12). The bone marrow ablation model induces intramembranous bone regeneration in the absence of an endochondral component (13) and mimics joint replacement surgery and dental implant surgery (14, 15). Our previous study of transcriptomic profiles of regenerating bone marrow documented the time-dependent gene expression patterns for osteogenesis, angiogenesis, and growth factor signaling (16). Interestingly, we found that an increase in periostin gene expression preceded the increases in expression of multiple well-recognized osteogenic genes such as Runx2 and Bglap.

Periostin is a matricellular protein that is abundantly expressed on the periosteal surface of cortical bone (17). Prior studies have demonstrated that periostin and periosteal cells play an important role in endochondral-mediated fracture repair (18-20). Periostin is highly upregulated during the early phase of fracture healing and its knockout impairs endochondral-mediated long bone fracture repair (21, 22). Whether cells with de novo periostin expression are required for intramedullary intramembranous bone regeneration has not been rigorously tested. Therefore, we sought to examine the role of these cells in intramembranous bone regeneration by performing bone marrow ablation surgery in mice where cells expressing periostin can be labeled fluorescently or depleted. We hypothesized that PECs are necessary to intramedullary intramembranous bone regeneration.

Materials and Methods

Generation of Postn-creER^T2BAC transgenic mice

Postn-creER^T2 transgenic mice were generated by pronuclear injection (PNI) with modified BAC DNA containing 124kb upstream and 65kb downstream genomic sequences of the Postn gene. BAC clone RP23-144B14 (BACPAC genomics) was modified using bacterial recombineering and replaced the Postn CDS with a CreERT2-polyA cassette preceded by a β Globin II intron. All cassette insertions were verified by PCR sequencing and the final modified BAC was confirmed as 201kb as well as passed restriction fragment analysis by pulse field gel electroporation. FVB/N zygotes underwent PNI with 2ng/ul of purified BAC DNA and transferred to recipient mice. Subsequent potential Tg founder animals were tail sampled at weaning and submitted for genetic screening. DNA was extracted and subjected to 5’ and 3’ junction PCR with the following primers: 5’fwd GCAGTCGTAAAAGTCAGAACTGTGG and 5’ rev ATGCATCTCAAATACCATTCATCCC (410bp), 3’ fwd CCACCAGCCAGCTATCAACTC and 3’ rev GGTAAAGGCCAATCTAACGTTCTGG (1500bp). Six Transgenic founders were identified and were further analyzed for copy number by qPCR with the following Cre specific oligos: fwd CCACCAGCCAGCTATCAACTC, rev CTTAGCGCCGTAAATCAATCG, probe FAM-CGCCCTGGAAGGGATTTTTGAAGCTAMRA and compared to a VIC labeled Actb reference reaction for a relative Ct method analysis. A two copy founder was identified and further backcrossed with C57BL/6J to produce N1 germline transmitting animals.

Mice

Animal studies were approved by the Rush University Medical Center Institutional Animal Care and Use Committee. Postn-creER^T2, Ai9-tdTomato (JAX7909), and ROSA-DTA (JAX9669) mice were used. To fluorescently label PECs, Postn-creER^T2 and Ai9-tdTomato creER^T2 mice were crossed to generate Postn-creER^T2;tdTomato mice. To deplete PECs, Postn-creER^T2 and ROSA-DTA mice were crossed to generate Postn-creER^T2;DTA mice. creER^T2 was induced by intraperitoneal administration (i.p.) of tamoxifen (100μg/g, Sigma-Aldrich) dissolved in corn oil. creER^T2;ROSA-DTA was induced by i.p. of tamoxifen dissolved corn oil. ROSA-DTA mice were also administered with tamoxifen. At 3 weeks of age, mice were weaned and group housed 2 to 5 mice per cage. Mice were maintained in a pathogen-free facility, subjected to a 12/12 hour light/dark cycle, had ad libitum access to standard laboratory rodent chow and water.

Bone marrow ablation surgery

Unilateral bone marrow ablation surgery was performed in the right femur of male and female 4-week-old mice using a previously published surgical procedure (23). In brief, the distal femur was breached through the intercondylar groove with a 23-gauge needle, followed by marrow reaming with a 25-gauge needle. After further mechanical ablation of the marrow with a 30-gauge needle, the marrow contents were flushed with 0.5 ml of sterile saline. Bone wax was applied to seal the entrance hole at the intercondylar groove. Mice were administered 0.05 mg/kg of buprenorphine for analgesia up to a day post-surgery and 5.0 mg/kg of cefazolin as antibiotic for the 2 days post-surgery. Calcein was injected i.p. 24-hour prior to tissue harvest. Mice were sacrificed using CO₂ inhalation and secondary cervical dislocation. Femurs were collected, fixed in 4% paraformaldehyde overnight and transferred to 70% EtOH for microcomputed tomography scanning and further processing for paraffin and cryo-histology.

Histology, immunofluorescence, and immunohistochemistry

Femurs were harvested, fixed in 4% paraformaldehyde overnight, and decalcified in 20% ethylenediamine tetraacetic acid (EDTA) for 2 weeks. Decalcified femurs were cryoprotected overnight in 30% sucrose/PBS, embedded in OCT compound (Tissue-Tek), and cryosectioned at 10 μm thickness using Cryojane system (Leica). For undecalcified tissue with calcein labels, sections were collected using a modified tape transfer system (24). Cryosections were warmed to the room temperature for 30 minutes, followed by PBS hydration and coverslipped with Prolong Diamond Antifade Mountant with DAPI (ThermoFisher).

Undecalcified cryosections were also used for immunofluorescence for Endomucin (ab106100, 1:100; Abcam, Cambridge, MA, USA) or Osterix (ab209484, 1:100; Abcam, Cambridge, MA, USA). Cryosections were warmed to room temperature, rehydrated and blocked in 1% BSA/PBS prior to overnight incubation with the primary antibody. Secondary antibody with FITC fluorophore (sc-2011, 1:200; Santa Cruz Biotechnology, Dallas, TX, USA) or AF647 fluorophore (A21245, 1:200; Thermo Fisher Scientific, Waltham, MA, USA) for Endomucin or Osterix, respectively.

To quantitate the number of PECs and their descendants, tdTomato fluorescently labeled cells within the regenerating bone marrow compartment (the medullary space excluding cortical bone from 40% to 70% of the total bone length proximal to the distal condyles) was counted by Osteomeasure (OsteoMetrics). The total number of tdTomato positive cells were normalized by the marrow area.

Immunohistochemistry was performed for Runx2 (12556, 1:200; Cell Signaling Technology, Inc., Danvers, MA, USA). Paraffin sections were rehydrated and following proteinase K antigen retrieval for 15 min at 37°C, endogenous peroxidase was quenched and slides were blocked with TNB before overnight incubation with the primary antibody. After detection with biotinylated secondary antibodies and tyramide amplification (Perkin Elmer, Waltham, MA, USA), signals were visualized using chromogen substrates and counterstained with fast green.

RT-qPCR

Regenerated bone marrow was disrupted and flushed with DPBS by inserting 25G syringe needle. Osteolineage (Runx2, Sp7, and Bglap) and endothelial (Emcn) gene expressions were evaluated by homogenizing the flushed bone marrow in Trizol (Thermo Fisher Scientific, Waltham, MA, USA), followed by isopropanol precipitation of RNA. RNA was purified (RNeasy Micro Kit; Qiagen, Waltham, MA, USA) and reverse transcribed with PrimeScript RT (Takara Bio USA, Inc, San Jose, CA, USA). cDNA expression was quantitated by qPCR (QuantStudio, ThermoFisher, USA). Target gene expression was normalized for actin in the same sample.

Flow cytometry

To dissociate cells, flushed regenerated bone marrow was incubated in 2 Wunsch units of Liberase (MilliporeSigma, Burlington, MA, USA; #5401127001) in 1mM CaCl₂, 0.1% BSA, 25 mM HEPES in α-MEM at 37°C for 15 mins for five cycle, 5mM EDTA with 0.1% BSA in PBS for 1 cycle, Liberase for one cycle, and EDTA for the final cycle. Dissociated cells from each cycle were collected, pooled, and filtered through 40 μm cell strainer. Cells were then rinsed in FACS buffer (0.5% BSA/PBS) and incubated in Fc-blocker (TruStain; BioLegend, San Diego, CA, USA; #101320) to prevent nonspecific binding of antibodies to cell-surface antigens. Cells were subsequently stained with anti-CD31 conjugated with AF488 (1:200 in FACS buffer; BioLegend, San Diego, CA, USA; #160207) in the dark for 30 min. Stained cells were analyzed by CytoFLEX S Flow Cytometer (Beckman Coulter, Indianapolis, IN).

Microcomputed tomography

Microcomputed tomographic (μCT) scanning was performed on the bone regenerating area of the right (marrow ablated) femur and the distal metaphysis and mid-diaphysis of the left (intact) femur using a high-resolution laboratory imaging system (μCT50, Scanco Medical AG, Brüttisellen, Switzerland) in accordance with the American Society of Bone and Mineral Research (ASBMR) guidelines for the use of μCT in rodents (25). Scans were acquired using a 7.4 μm³ isotropic voxel, 70 kVp and 114 μA peak x-ray tube potential and intensity, 300 ms integration time, and were subjected to Gaussian filtration. The region of interest (ROI) for microCT analysis of the regenerating bone was the medullary space from 40% to 70% of the total bone length proximal to the distal condyles. This compartment is normally devoid of bone. Regenerating bone dependent variables included bone volume fraction (BV/TV, mm³/mm³).

Tissue clearing and lightsheet microscopy

Femurs underwent PEGASOS tissue clearing that renders tissue to be transparent and allows optical sectioning via lightsheet microscopy (26). Following tissue clearing, femurs were imaged by LaVision BioTec UltraMicroscope II (Miltenyi Biotec) run by ImSpector Pro v. 7_124 software (LaVision BioTec) to visualize tdTomato positive cells in 3D. Images were imported to Imaris (Oxford Instruments), and the number of tdTomato positive cells normalized by the bone marrow volume was quantitated using Spot Detector.

Statistical analysis

Data were analyzed with Prism 9 (GraphPad Software, La Jolla, CA) and RStudio version 1.3.1093. Student’s t-test was used to compare intact vs. surgery limbs. Differences were considered significant at p < 0.05. Data are reported as mean ± SD.

Results

We first sought to determine distribution of periostin expressing cells (PECs) in intact bone. Daily tamoxifen was administered from the ages of 27 to 30 days old in Postn-creER^T2;tdTomato mice. We also similarly administered oil without tamoxifen to Postn-creER^T2;tdTomato mice and tamoxifen to tdTomato mice, which demonstrated no spontaneous tdTomato expression (Suppl. Fig. 1). At days 31 and 35, which are 1 and 5 days after the last tamoxifen administration, PECs were distributed on the perichondrium and periosteum of the intact femur, but were absent in the growth plate and bone marrow cavity (Fig. 1).

Figure 1.

Open in a new tab

To determine if cells transiently expressing periostin are distributed within the regenerating bone marrow, we performed bone marrow ablation surgery in the right femur of Postn-creER^T2;tdTomato mice at 28 days of age. The left femur served as an intact internal control. Tamoxifen was administered daily from days 27 to 30, which corresponds to the timing of increased periostin expression that precedes increased expression of osteogenic genes following bone marrow ablation surgery (16) (Fig. 2A). PECs in the intact left femur were restricted to the periosteal surface, whereas de novo PECs were observed within the regenerating bone, with significant increase in the number of tdTomato positive cells within the right femur bone marrow compared to the left (Fig. 2B). We further quantitated the number of tdTomato positive cells in 3D using light sheet microscopy of PEGASOS-cleared femurs, and confirmed our observation from 2D sections of a dramatic increase in the number of tdTomato positive cells within the regenerating bone marrow compared to the intact bone marrow (Fig. 2C).

Figure 2.

Open in a new tab

We then sought to examine whether de novo PECs giving rise to endothelial cells or bone forming osteoblasts by endomucin immunofluorescence, flow cytometry for CD31, an endothelial cell marker, calcein, or osterix immunofluorescence. We found that approximately 20% of tdTomato positive cells expressed endomucin, 43% expressed CD31, 37% overlapped with calcein positive matrix, and 47% expressed osterix (Fig. 3).

Figure 3.

Open in a new tab

To determine if de novo PECs are required for intramembranous bone regeneration, Postn-creER^T2;DTA mice underwent bone marrow ablation surgery at 28 days of age, with daily tamoxifen administration from days 27 to 30 (Fig. 4A). MicroCT analysis of tissues harvested at 7 days after surgery demonstrated that diphtheria toxin-mediated depletion of de novo PECs impaired intramembranous bone regeneration, where regenerated BV/TV was lower by 71% in the PEC-depleted mice compared to their littermate controls (Fig. 4B). In addition, several early osteogenic gene expressions such as Runx2 (78%) and Sp7 (74%) decreased in regenerating bone following PEC depletion (Fig. 4C), whereas no change was observed in Bglap expression. Also, endothelial cell expression Emcn was decreased by 56% in regenerating bone due to PEC depletion. Lower Runx2 immunoreactivity (Fig. 4D) in PEC-depleted mice also confirmed decreased Runx2 gene expression.

Figure 4.

Open in a new tab

We then pulse-chased the PECs and their descendants by administering tamoxifen at 7 days of age and harvesting tissues at 8, 14, and 28 days of age. Oil-only administered Postn-creER^T2;tdTomato mice and tamoxifen administered tdTomato mice did not demonstrate spontaneous tdTomato expression in any of the ages (Suppl. Fig. 2). In tamoxifen administered Postn-creER^T2;tdTomato mice, at days 8 and 14, a limited number of tdTomato positive cells were present at the diaphyseal periosteal surface and some were found on the perichondrium (Fig. 5). By day 28, tdTomato positive cells were more abundant on the perichondrium and periosteum. No tdTomato positive cells were present in bone marrow or the growth plate.

Figure 5.

Open in a new tab

To examine if PEC descendants are present within the regenerating bone region, we administered tamoxifen to 7-day-old mice, performed surgery at 28 days of age, and harvested femurs at day 35. We found that in the intact bone, tdTomato positive cells were predominantly on the periosteal surface with limited presence within the bone marrow cavity. In contrast, tdTomato positive cells were abundant within regenerating tissue within the bone marrow cavity, with approximately 9.2-fold increase (p < 0.01) in the number of tdTomato positive cells compared to the intact bone marrow cavity.

Discussion

Our study demonstrates that de novo PECs are critical to intramedullary intramembranous bone regeneration in mice. Fluorescently labeled PECs are normally restricted to the perichondrium and periosteal surface in intact bone, but are present within the regenerating tissue following marrow ablation surgery in mice. Lightsheet microscopy imaging of tdTomato fluorescently labeled cells demonstrated condensation of PECs, which likely corresponds to de novo bone forming region. Diphtheria-mediated depletion of de novo PECs impairs intramembranous bone regeneration. PEC descendants, which are normally restricted to the periosteal surface, are present within the regenerating marrow compartment despite the cortical bone remaining intact.

Our study suggests heterogeneity of cells transiently expressing periostin during intramembranous bone regeneration. While generally considered to be exclusively expressed by cells on the perichondrium and periosteal surface in intact bones, endothelial cells are also likely expressing periostin during intramembranous bone regeneration (i.e., following mechanical disruption of the bone marrow cavity). Although prior studies in bone regeneration have not reported expression of periostin in endothelial cells, studies in other tissues such as during cardiac development demonstrates that periostin is expressed in the endothelium and its absence leads to leaflet abnormalities (27, 28). With increased periostin expression, endothelial cells are thought to undergo endothelial-to-mesenchymal transformation (29). Whether these newly transformed mesenchymal cells contribute to intramembranous bone regeneration in our model is unknown.

Bone marrow pericytes or reticular cells also appear to express periostin during intramembranous bone regeneration. Pericytes are a heterogenous cell population that have been shown to give rise to multiple cell types, including osteoblasts, chondrocytes, and adipocytes in vitro (30). During fracture healing, αSMA positive pericytes have been shown to express markers of osteochondroprogenitors and give rise to osteoblasts and chondrocytes in vivo (31-33). CXCL12-abundant reticular (CAR) cells are a subset of reticular cells that have also been shown to give rise to new bone following marrow ablation surgery (34). Single-cell analysis of these CAR cells from bone marrow ablated femurs demonstrated increased expression of periostin compared to control femurs. These studies suggest that in addition to endothelial cells, pericytes, and reticular cells are also expressing periostin and may contribute to intramembranous bone regeneration.

An intriguing source that gives rise to cells that contribute to bone regeneration in the marrow compartment is the periosteal surface. By giving tamoxifen three weeks prior to surgery, tdTomato positive cells that were observed in the marrow compartment are likely the descendants of periosteal PECs that were on the periosteum at the time of tamoxifen administration, rather than the PECs that were labeled as tdTomato positive at the time of surgery. Prior studies have demonstrated in vivo migration potential of Mx1 and αSMA double positive skeletal stem cells that reside on the periosteum following calvarial or tibial injuries in mice (35). Within 48 hours, these double positive cells migrated from the periosteal surface toward the defect site. While femoral periosteal PECs may similarly have migratory potential, how they migrate through the intact cortical bone toward the marrow ablation site is unclear. A recent study has demonstrated an abundance of trans-cortical capillaries in long bones (36), suggesting possible routes for periosteal residing PECs to migrate and contribute to intramembranous bone regeneration.

Future studies need to explore the functional role of periostin in intramedullary intramembranous bone regeneration. One possible role of periostin is the maintenance of progenitor cells, which can be activated upon injuries such as bone fracture (22). Another possibility is that periostin promotes migration of progenitors or other essential cells required for intramembranous bone regeneration. Periostin has been shown to bind to integrin receptors such as αvβ3 and αvβ5 to promote migration of smooth muscle cells and periodontal ligament fibroblasts (37, 38). Given the absence of periostin expression in the intact bone marrow cavity, the likely explanation of a sudden increase in periostin expressing cells following marrow ablation surgery is that periostin promotes migration of progenitor cells from the endosteal, periosteal, or perivascular areas, rather than maintaining progenitor cells within the bone marrow cavity.

In conclusion, our study demonstrates that cells transiently expressing periostin are required for intramedullary intramembranous bone regeneration. Further elucidating the role of periostin and PECs in bone regeneration may provide novel therapeutic opportunities for clinical procedures that are dependent on intramembranous bone regeneration.

Supplementary Material

NIHMS1943633-supplement-1.docx^{(5.7MB, docx)}

Figure 6.

Open in a new tab

Highlights.

Periostin expressing cells are located on the periosteal surface of the cortical bone and absent in bone marrow
Upon mechanical ablation of bone marrow, cells within the regenerating bone marrow compartment express periostin
Depletion of cells transiently expressing periostin impairs intramembranous bone regeneration

Acknowledgments

This study was supported by Cohn Research Fellowship, K01AR077679, and R01AR079179. The content is solely the responsibility of the authors and does not necessarily represent the official views of the National Institutes of Health. Rush University Medical Center MicroCT/Histology Core provided experimental support. Lightsheet microscopy was performed in the Integrated Light Microscopy Core at University of Chicago, which receives financial support from the Cancer Center Support Grant (P30CA014599).

Funding Source:

Rush University Cohn Fellowship, K01AR077679, R01AR079179

Footnotes

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

References

1.Einhorn TA, Gerstenfeld LC. Fracture healing: mechanisms and interventions. Nat Rev Rheumatol. 2015;11(1):45–54. Epub 2014/10/01. doi: 10.1038/nrrheum.2014.164. [DOI] [PMC free article] [PubMed] [Google Scholar]
2.Marsell R, Einhorn TA. The biology of fracture healing. Injury. 2011;42(6):551–5. [DOI] [PMC free article] [PubMed] [Google Scholar]
3.Wong SA, Rivera KO, Miclau T 3rd, Alsberg E, Marcucio RS, Bahney CS. Microenvironmental Regulation of Chondrocyte Plasticity in Endochondral Repair-A New Frontier for Developmental Engineering. Front Bioeng Biotechnol. 2018;6:58. Epub 2018/06/06. doi: 10.3389/fbioe.2018.00058. [DOI] [PMC free article] [PubMed] [Google Scholar]
4.Schindeler A, McDonald MM, Bokko P, Little DG. Bone remodeling during fracture repair: The cellular picture. Semin Cell Dev Biol. 2008;19(5):459–66. Epub 2008/08/12. doi: 10.1016/j.semcdb.2008.07.004. [DOI] [PubMed] [Google Scholar]
5.Ko FC, Sumner DR. How faithfully does intramembranous bone regeneration recapitulate embryonic skeletal development?Dev Dyn. 2020. Epub 2020/08/20. doi: 10.1002/dvdy.240. [DOI] [PubMed] [Google Scholar]
6.United States B, Joint D. The Burden of Musculoskeletal Diseases in the United States. American Academy of Orthopaedic Surgeons; 2008. [Google Scholar]
7.Iorio R, Robb WJ, Healy WL, Berry DJ, Hozack WJ, Kyle RF, Lewallen DG, Trousdale RT, Jiranek WA, Stamos VP, Parsley BS. Orthopaedic surgeon workforce and volume assessment for total hip and knee replacement in the United States: preparing for an epidemic. J Bone Joint Surg Am. 2008;90(7):1598–605. Epub 2008/07/03. doi: 10.2106/JBJS.H.00067. [DOI] [PubMed] [Google Scholar]
8.Daubert DM, Weinstein BF, Bordin S, Leroux BG, Flemming TF. Prevalence and predictive factors for peri-implant disease and implant failure: a cross-sectional analysis. J Periodontol. 2015;86(3):337–47. Epub 2014/11/22. doi: 10.1902/jop.2014.140438. [DOI] [PubMed] [Google Scholar]
9.Steinberg B, Martin RA. Removal of bone marrow in living animals. Proc Soc Exp Biol Med. 1946;61:428. Epub 1946/04/01. doi: 10.3181/00379727-61-15342. [DOI] [PubMed] [Google Scholar]
10.Cooper GM, Mooney MP, Gosain AK, Campbell PG, Losee JE, Huard J. Testing the critical size in calvarial bone defects: revisiting the concept of a critical-size defect. Plastic and reconstructive surgery. 2010;125(6):1685–92. Epub 2010/06/03. doi: 10.1097/PRS.0b013e3181cb63a3. [DOI] [PMC free article] [PubMed] [Google Scholar]
11.Yu YY, Bahney C, Hu D, Marcucio RS, Miclau T III. Creating rigidly stabilized fractures for assessing intramembranous ossification, distraction osteogenesis, or healing of critical sized defects. JVisExp. 2012(62). [DOI] [PMC free article] [PubMed] [Google Scholar]
12.Wohl GR, Towler DA, Silva MJ. Stress fracture healing: fatigue loading of the rat ulna induces upregulation in expression of osteogenic and angiogenic genes that mimic the intramembranous portion of fracture repair. Bone. 2009;44(2):320–30. Epub 2008/10/28. doi: 10.1016/j.bone.2008.09.010. [DOI] [PMC free article] [PubMed] [Google Scholar]
13.Moran MM, Sena K, McNulty MA, Sumner DR, Virdi AS. Intramembranous bone regeneration and implant placement using mechanical femoral marrow ablation: rodent models. BoneKEy reports. 2016;5:837. Epub 2016/09/21. doi: 10.1038/bonekey.2016.61. [DOI] [PMC free article] [PubMed] [Google Scholar]
14.Lybrand K, Bragdon B, Gerstenfeld L. Mouse models of bone healing: fracture, marrow ablation, and distraction osteogenesis. Current protocols in mouse biology. 2015;5(1):35–49. Epub 2015/03/03. doi: 10.1002/9780470942390.mo140161. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Patt HM, Maloney MA. Bone marrow regeneration after local injury: a review. Experimental Hematology. 1975;3:135–48. [PubMed] [Google Scholar]
16.Wise JK, Sena K, Vranizan K, Pollock JF, Healy KE, Hughes WF, Sumner DR, Virdi AS. Temporal gene expression profiling during rat femoral marrow ablation-induced intramembranous bone regeneration. PLoS One. 2010;5(10). Epub 2010/10/20. doi: 10.1371/journal.pone.0012987. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Horiuchi K, Amizuka N, Takeshita S, Takamatsu H, Katsuura M, Ozawa H, Toyama Y, Bonewald LF, Kudo A. Identification and characterization of a novel protein, periostin, with restricted expression to periosteum and periodontal ligament and increased expression by transforming growth factor beta. J Bone Miner Res. 1999;14(7):1239–49. Epub 1999/07/15. doi: 10.1359/jbmr.1999.14.7.1239. [DOI] [PubMed] [Google Scholar]
18.Duchamp de Lageneste O, Colnot C. Periostin in Bone Regeneration. Adv Exp Med Biol. 2019;1132:49–61. Epub 2019/05/01. doi: 10.1007/978-981-13-6657-4_6. [DOI] [PubMed] [Google Scholar]
19.Debnath S, Yallowitz AR, McCormick J, Lalani S, Zhang T, Xu R, Li N, Liu Y, Yang YS, Eiseman M, Shim JH, Hameed M, Healey JH, Bostrom MP, Landau DA, Greenblatt MB. Discovery of a periosteal stem cell mediating intramembranous bone formation. Nature. 2018;562(7725):133–9. Epub 2018/09/27. doi: 10.1038/s41586-018-0554-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
20.Colnot C. Skeletal cell fate decisions within periosteum and bone marrow during bone regeneration. J Bone Miner Res. 2009;24(2):274–82. Epub 2008/10/14. doi: 10.1359/jbmr.081003. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Nakazawa T, Nakajima A, Seki N, Okawa A, Kato M, Moriya H, Amizuka N, Einhorn TA, Yamazaki M. Gene expression of periostin in the early stage of fracture healing detected by cDNA microarray analysis. J Orthop Res. 2004;22(3):520–5. Epub 2004/04/22. doi: 10.1016/j.orthres.2003.10.007. [DOI] [PubMed] [Google Scholar]
22.Duchamp de Lageneste O, Julien A, Abou-Khalil R, Frangi G, Carvalho C, Cagnard N, Cordier C, Conway SJ, Colnot C. Periosteum contains skeletal stem cells with high bone regenerative potential controlled by Periostin. Nat Commun. 2018;9(1):773. Epub 2018/02/24. doi: 10.1038/s41467-018-03124-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Ko FC, Moran MM, Ross RD, Sumner DR. Activation of canonical Wnt signaling accelerates intramembranous bone regeneration in male mice. J Orthop Res. 2021. Epub 2021/11/24. doi: 10.1002/jor.25217. [DOI] [PMC free article] [PubMed] [Google Scholar]
24.Yang Y, Liu Q, Zhang L, Fu X, Chen J, Hong D. A modified tape transfer approach for rapidly preparing high-quality cryosections of undecalcified adult rodent bones. J Orthop Translat. 2021;26:92–100. Epub 2021/01/14. doi: 10.1016/j.jot.2020.03.001. [DOI] [PMC free article] [PubMed] [Google Scholar]
25.Bouxsein ML, Boyd SK, Christiansen BA, Guldberg RE, Jepsen KJ, Muller R. Guidelines for assessment of bone microstructure in rodents using micro-computed tomography. Journal of Bone and Mineral Research. 2010;25(7):1468–86. [DOI] [PubMed] [Google Scholar]
26.Jing D, Zhang S, Luo W, Gao X, Men Y, Ma C, Liu X, Yi Y, Bugde A, Zhou BO, Zhao Z, Yuan Q, Feng JQ, Gao L, Ge WP, Zhao H. Tissue clearing of both hard and soft tissue organs with the PEGASOS method. Cell Res. 2018;28(8):803–18. Epub 2018/05/31. doi: 10.1038/s41422-018-0049-z. [DOI] [PMC free article] [PubMed] [Google Scholar]
27.Norris RA, Kern CB, Wessels A, Moralez EI, Markwald RR, Mjaatvedt CH. Identification and detection of the periostin gene in cardiac development. Anat Rec A Discov Mol Cell Evol Biol. 2004;281(2):1227–33. Epub 2004/11/09. doi: 10.1002/ar.a.20135. [DOI] [PubMed] [Google Scholar]
28.Snider P, Hinton RB, Moreno-Rodriguez RA, Wang J, Rogers R, Lindsley A, Li F, Ingram DA, Menick D, Field L, Firulli AB, Molkentin JD, Markwald R, Conway SJ. Periostin is required for maturation and extracellular matrix stabilization of noncardiomyocyte lineages of the heart. Circ Res. 2008;102(7):752–60. Epub 2008/02/26. doi: 10.1161/CIRCRESAHA.107.159517. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Norris RA, Moreno-Rodriguez RA, Sugi Y, Hoffman S, Amos J, Hart MM, Potts JD, Goodwin RL, Markwald RR. Periostin regulates atrioventricular valve maturation. Dev Biol. 2008;316(2):200–13. Epub 2008/03/04. doi: 10.1016/j.ydbio.2008.01.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.James AW, Peault B. Perivascular Mesenchymal Progenitors for Bone Regeneration. J Orthop Res. 2019;37(6):1221–8. Epub 2019/03/26. doi: 10.1002/jor.24284. [DOI] [PMC free article] [PubMed] [Google Scholar]
31.Grcevic D, Pejda S, Matthews BG, Repic D, Wang L, Li H, Kronenberg MS, Jiang X, Maye P, Adams DJ, Rowe DW, Aguila HL, Kalajzic I. In vivo fate mapping identifies mesenchymal progenitor cells. Stem Cells. 2012;30(2):187–96. Epub 2011/11/16. doi: 10.1002/stem.780. [DOI] [PMC free article] [PubMed] [Google Scholar]
32.Matthews BG, Grcevic D, Wang L, Hagiwara Y, Roguljic H, Joshi P, Shin DG, Adams DJ, Kalajzic I. Analysis of alphaSMA-labeled progenitor cell commitment identifies notch signaling as an important pathway in fracture healing. J Bone Miner Res. 2014;29(5):1283–94. Epub 2013/11/06. doi: 10.1002/jbmr.2140. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Matthews BG, Novak S, Sbrana FV, Funnell JL, Cao Y, Buckels EJ, Grcevic D, Kalajzic I. Heterogeneity of murine periosteum progenitors involved in fracture healing. Elife. 2021;10. Epub 2021/02/10. doi: 10.7554/eLife.58534. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Matsushita Y, Nagata M, Kozloff KM, Welch JD, Mizuhashi K, Tokavanich N, Hallett SA, Link DC, Nagasawa T, Ono W, Ono N. A Wnt-mediated transformation of the bone marrow stromal cell identity orchestrates skeletal regeneration. Nat Commun. 2020;11(1):332. Epub 2020/01/18. doi: 10.1038/s41467-019-14029-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Ortinau LC, Wang H, Lei K, Deveza L, Jeong Y, Hara Y, Grafe I, Rosenfeld SB, Lee D, Lee B, Scadden DT, Park D. Identification of Functionally Distinct Mx1+alphaSMA+ Periosteal Skeletal Stem Cells. Cell Stem Cell. 2019;25(6):784–96 e5. Epub 2019/12/07. doi: 10.1016/j.stem.2019.11.003. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Gruneboom A, Hawwari I, Weidner D, Culemann S, Muller S, Henneberg S, Brenzel A, Merz S, Bornemann L, Zec K, Wuelling M, Kling L, Hasenberg M, Voortmann S, Lang S, Baum W, Ohs A, Kraff O, Quick HH, Jager M, Landgraeber S, Dudda M, Danuser R, Stein JV, Rohde M, Gelse K, Garbe AI, Adamczyk A, Westendorf AM, Hoffmann D, Christiansen S, Engel DR, Vortkamp A, Kronke G, Herrmann M, Kamradt T, Schett G, Hasenberg A, Gunzer M. A network of trans-cortical capillaries as mainstay for blood circulation in long bones. Nat Metab. 2019;1(2):236–50. Epub 2019/10/18. doi: 10.1038/s42255-018-0016-5. [DOI] [PMC free article] [PubMed] [Google Scholar]
37.Matsuzawa M, Arai C, Nomura Y, Murata T, Yamakoshi Y, Oida S, Hanada N, Nakamura Y. Periostin of human periodontal ligament fibroblasts promotes migration of human mesenchymal stem cell through the alphavbeta3 integrin/FAK/PI3K/Akt pathway. J Periodontal Res. 2015;50(6):855–63. Epub 2015/04/23. doi: 10.1111/jre.12277. [DOI] [PubMed] [Google Scholar]
38.Lindner V, Wang Q, Conley BA, Friesel RE, Vary CP. Vascular injury induces expression of periostin: implications for vascular cell differentiation and migration. Arterioscler Thromb Vasc Biol. 2005;25(1):77–83. Epub 2004/10/30. doi: 10.1161/01.ATV.0000149141.81230.c6. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

NIHMS1943633-supplement-1.docx^{(5.7MB, docx)}